EST details — SGN-E224782

Search information 
Request: 224782Match: SGN-E224782
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C56071Clone name: cLEL-27-N21
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C56071 [cLEL-27-N21] Trace: SGN-T12574 EST: SGN-E224562 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E224782Length: 356 bp (889 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E224782 [] (trimmed) GCAGGGAATTTGACTTTAGTTTATATTTATATTCTTCAATTTTGAGTATACACAAATCGATGCTTTGACTTATATAAAATTGAATAAGTAGCTAC
ACGTGTTGTGCATAAACCAATAAATTCGAGAAAATGGCACCATTAGCAGCAAACCAGGAAAAGTAGAGTCTTTATAGCACATGAGTTGGGTAATT
TGTGAAATTAGGTCTTAGGCCTAACTCACACCCCAAAAGTTAGCTCGAAGAATTGCCCAAGCCTTATAAGGAGTCCACCCATCTCATTAACCACC
GATGAGCAACTTTTAGTCGTTCTTTAACATATTGGTGGCGGAATGTCCTGGAAATGTGCCTTTACCAGCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E224782] SGN-U579027 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T12794 [Download][View] Facility Assigned ID: cC-esflcLEL27N21a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0150 Quality Trim Threshold: 14.5