EST details — SGN-E227072

Search information 
Request: 227072Match: SGN-E227072
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17541Clone name: cLED-1-A13
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17541 [cLED-1-A13] Trace: SGN-T48583 EST: SGN-E227071 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E227072Length: 328 bp (814 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E227072 [] (trimmed) CACACCAATTTATTTCCTCTTTATTTCAATTCTTCGACAAAATTTTTCAATAATATGTTTGTAACGTTAACAGTTTAGATTAGCAAATTCAAAAC
TCGAAATTTATAAGCTAGTAATGTCATTACAAATACGTGAAATCAAGAGTTGAATCGTGACGTAAATTCCGTGTTACCAAATTACTGTTGGGCAC
ATTGAACTCTTTGTGCACCACCATGCTTGTTTTTATCGTCTTCGGAGAATGCCTTTTGGGCCTGTTGCTGCTTCCTACGCATTTCCTTTTCGATG
TTAACTTTATGTAACGTGGTCTCCTTGCACTCGTCCAATTCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E227072] SGN-U578090 Tomato 200607 Build 2 217 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48584 [Download][View] Facility Assigned ID: TOVAA07TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.876 Expected Error Rate: 0.0248 Quality Trim Threshold: 14.5