Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E227710

Search information 
Request: 227710Match: SGN-E227710
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C57036Clone name: cLEL-30-M14
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E227710Length: 259 bp (992 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E227710 [] (trimmed) GGGGTTTTTTGGAACCTTTACTACCATATTGCTACCTTTGCATTGGTAAAATTTATATACTGTTACATTTGGGCTAGAGCATAAAGAAGATAACT
GTATTAAGAGGAAAAAGCTTGAAGGGACAAATTCAAGCTTTGGTTACTTTTTTTTTACACTCAACGGGTTTTTTACAGGGAAATGTTTAATGGGA
ATTTTTTACAAACCAAGAGCTCCAAGGGGGGTCTTCCCTTGGCCAGCCTCAAAATAGAAAATTAACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E227710] SGN-U591270 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T14275 [Download][View] Facility Assigned ID: cC-esflcLEL30M14a1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.862 Expected Error Rate: 0.0301 Quality Trim Threshold: 14.5