Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E234164

Search information 
Request: 234164Match: SGN-E234164
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60436Clone name: cLEL-8-B23
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E234164Length: 238 bp (938 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E234164 [] (trimmed) TTTTTTTGAGTTTTTCTTCAATATGACCAACTTCAGCCTCCTTCTTCTCCAGTTCAATCACCTTGTTTTCCAGTTCCTCATCTAGTGATGCATGC
CTCTGTCTCATCTCTAATTCAAACTCCTCCTCCTTAGATTTCAGGATAGCTCTATGTTCATCCATTAGCTTTTGAATTTCCTCTCTTTCTTTTGC
ATTTAGCTTTTCCTGTAGTTCATCTAATTCTTCCTTTTTTATCTCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E234164] SGN-U604241 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T19150 [Download][View] Facility Assigned ID: cC-esflcLEL8B23d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.829 Expected Error Rate: 0.0027 Quality Trim Threshold: 12.5