EST details — SGN-E235522

Search information 
Request: 235522Match: SGN-E235522
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C15271Clone name: cLED-11-H11
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184343 is on microarray TOM1: SGN-S1-1-4.1.16.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184343 [TUS-44-I13] Trace: SGN-T191895 EST: SGN-E390569 Direction: 5' Facility: INRA
Clone: SGN-C184343 [TUS-44-I13] Trace: SGN-T192127 EST: SGN-E390801 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235522Length: 504 bp (819 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E235522 [] (trimmed) AAATTTAATTCGATTTTTATAGAGTAATCAAAACAGACATCGTTTAAATTTTTACAATTACCAACCAACATATAATTTACACGATTTAAAATGAG
AGAATTTTATACATCCCAAATTCACACCAACTAATTTGATTTTTAACTATCCATGAACAAATCAAAGAATACAAAAACCGCTCACATAAGAAAAA
AAAAATTTCTTTACTAATGGGTATCTTTGAATAATTGGAAAGACTTAGAAGACTTCAACTGATCACTTATGTAGCCTTCGATCTGGCAATCTATC
AGGCAACTTTATAGTTCAAATAACTCTGGGATCACTACCAAAGGGTCTTCATGTTCTCAATTTATCAAGGAACAAGATCCACACAATTGAAGGAC
TGGGGGAATTGACACGTTTGCGCTTGCTTGACCTAAGTTACAACAGAATCTTTCGAATTGGACAAGGGTTGTCGAATTGTACTCTTATCAAAGAG
CTCTACCTCGCTGGTAACAAAATAAGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235522] SGN-U594667 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51532 [Download][View] Facility Assigned ID: TOVBQ42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.910 Expected Error Rate: 0.0152 Quality Trim Threshold: 14.5