EST details — SGN-E242998

Search information 
Request: 242998Match: SGN-E242998
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21188Clone name: cLED-31-P22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169544 [TUS-5-P22] Trace: SGN-T350874 EST: SGN-E549999 Direction: 5' Facility: Avesthagen
Clone: SGN-C169544 [TUS-5-P22] Trace: SGN-T351099 EST: SGN-E550224 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E242998Length: 300 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E242998 [] (trimmed) AAAGAGGCGATCACGCCGTCACAGACACAAAGATAGTGAAAATGCAGGCGAGGATGAAGATGATGAAGATAATAGGCGATCAAGAAAGAAGCACC
ACAAAAGGCATTCATCCCCTGAAAATGATGATGATCAAAGAGATGCAGAGAGACATCATAAGCATGGAAGCAAAAAGCATTCAAGTCATCGGTCT
TCACGTGAAAATTGGAAAGATGACGATGAGGGGGACTATAAACATTCCAAGAAGAAACATAGATCTCATAGAAGCTCCCATCGCAGTAGAGATAG
ACATGAACACAAGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E242998] SGN-U599885 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56917 [Download][View] Facility Assigned ID: TOVET95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0143 Quality Trim Threshold: 14.5