Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E243998

Search information 
Request: 243998Match: SGN-E243998
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25105Clone name: cLEE-1-M17
cartOrder Clone
Library Name: cLEEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seeds and maturing carpels
Development Stage: 5 days post-anthesis to fruit over-ripe stage

Microarray: Alias clone SGN-C183709 is on microarray TOM1: SGN-S1-1-6.3.1.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C25105 [cLEE-1-M17] Trace: SGN-T58448 EST: SGN-E243999 Direction: 3' Facility: TIGR
Clone: SGN-C183709 [TUS-42-O3] Trace: SGN-T195503 EST: SGN-E394177 Direction: 3' Facility: INRA
Clone: SGN-C183709 [TUS-42-O3] Trace: SGN-T195972 EST: SGN-E394646 Direction: 5' Facility: INRA
Clone: SGN-C183709 [TUS-42-O3] Trace: SGN-T195972 EST: SGN-E399197 Direction: 5' Facility: INRA
Clone: SGN-C183709 [TUS-42-O3] Trace: SGN-T200258 EST: SGN-E399196 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243998Length: 523 bp (800 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E243998 [] (trimmed) CAGTTTGGACATCAACAAAATTTCTTCAAGGTGTGATTGCATGTCAACAACAATTTCAAGCTCGGGATAGTGATATCATTCTTGTTACAAGTCCA
AAATCAGGAAGTACTTGGTTAAAATCACTTCTATTCGCTCTAGTGAATAGGGTGAAACATCCTATTTTTGTACCTAATCACCCTTTACTTGTCGA
GAACCCTCATGTTCTTGTTCCATTCTTAGAGCATACACTCTATGTTGATGGTCAAGTCATTGATTTTTCAACCAACACTTCACCTAGACTTTTGG
CAACTCATGTGCCCTTTGCTTCATTGCCAGAATCAGTCCACGATTCAAAAACCAAACTTATTTACTTATGTAGGAATCCTAGGGACACTTTTATT
TCTATGTGGCATTTTGCAAACAATTTATTACTTCATCATAAAGATACTAATTCCATTGAAGAAATGTTTGATCTTTTTTGTAAAGGGGTGAGCCT
TTATGGTCCATTTTGGAATCACGTGTTGGATTATTGGAAACAAAGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243998] SGN-U567882 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58447 [Download][View] Facility Assigned ID: TSEAA81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5