EST details — SGN-E244064

Search information 
Request: 244064Match: SGN-E244064
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25153Clone name: cLEE-1-P23
cartOrder Clone
Library Name: cLEEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seeds and maturing carpels
Development Stage: 5 days post-anthesis to fruit over-ripe stage

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244064Length: 375 bp (787 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E244064 [] (trimmed) CAGCTTTGCAGGGTAAGAAGAAACGATACAATGATGGTGGCGATTCACGAAATCGTCAGGATCACATCAATGAGTTGATATCTAAGATGAATTAG
CATAGACACCCGGGTTTCCAAACCAAATTTTTGTTGAGTGTTATAATATAGATTGGTATGGGTTATTGTAAAAGATGGAGCATCGCAATCACTAT
ACTAGGTGCTATTCCTTATCCTCCACCCATTCATGTCATGTATTGTGTCTCAAGCCATTAGAAGGTATCATTGTATCTTCTTTCCGCTACTATTT
TCATACTGCTGAAGTTAAAATGCCAAAAATGTACCTACTACATTATTATCAATGAAAAAAGAGCAGTTAAAAATCATGGAGGATTCTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244064] SGN-U599740 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58513 [Download][View] Facility Assigned ID: TSEAC96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0181 Quality Trim Threshold: 14.5