EST details — SGN-E244648

Search information 
Request: 244648Match: SGN-E244648
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C22444Clone name: cLED-38-E11
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244648Length: 325 bp (812 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E244648 [] (trimmed) AATTCGGCACCAGGCAGCAATTTTTCTTTTTTTTACCCTCCAAGTTTTACAACCTCCATTAGGAGTTTCTGCCGCCACCATAGGAAAGACGGTAA
CCGTTTTGAGTATCGATGGAGGTGGTATTAGAGGCATTATTCCTGGAACCCTACTTGCCTTCCTTGAATCTAAACTTCAGGAACTTGATGGACCA
AATGCAAAAATTGCAGATTACTCCAATGTAGTAGCAGGAACAAGCACAGGTGGATTAGTAACAACTATGCTTACTGCTCCTAACAAGGATAATCG
ATCTTTATATCAGGCAAAAGATTATTTCCAATATCTACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244648] SGN-U589172 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58260 [Download][View] Facility Assigned ID: TOVFS30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0285 Quality Trim Threshold: 14.5