Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E246613

Search information 
Request: 246613Match: SGN-E246613
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27813Clone name: cLEF-45-J4
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176757 is on microarray TOM1: SGN-S1-1-6.1.9.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176757 [TUS-24-M11] Trace: SGN-T192982 EST: SGN-E391656 Direction: 5' Facility: INRA
Clone: SGN-C176757 [TUS-24-M11] Trace: SGN-T193215 EST: SGN-E391889 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246613Length: 486 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246613 [] (trimmed) CGTACAGGGACTTTTCCAATAAGGAATCCTCTTCAAGTTCTCATCACCAAAAATCTAACACAAACTCTGGACGTGTCAGCTTCATTGATGGTCAC
CCCTCAAAGAAGTCTTCGTCAGAAAAGCGGCCAGTACCCAGAAGGAAGTCAAGGAAGCATGCTTGTGAGATGAAAATTTTGAATGCTAGTGCCCT
TCTTGTGGAACCTCTGGAAAGTCGAAAATTTTCAAGGTTTTCGTTGCAGTACGCGGAAACAGAGGACAAACCTTTTGACGATGCAAACTGGGAAC
CTAGATTTTCTGGGCATCAAAGTATGGAAGAACGGGAAGAATCTTTTCTTGCACGCAATCAAAAAATAAACTGTGGTTTTGTTCGAGGCCCTGAA
GAAACTCCAAGTACCGGATTTGACTTGGCAGAAGATGACGCAAAATACATTAGCAGTTGTCACATTGCTGTAGCTTCATGCATCTTCGGAAATTC
GGATCGCTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246613] SGN-U604334 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61348 [Download][View] Facility Assigned ID: TMGGX50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5