EST details — SGN-E247024

Search information 
Request: 247024Match: SGN-E247024
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26859Clone name: cLEF-41-M24
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169722 [TUS-6-H8] Trace: SGN-T350666 EST: SGN-E549791 Direction: 5' Facility: Avesthagen
Clone: SGN-C169722 [TUS-6-H8] Trace: SGN-T351440 EST: SGN-E550565 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247024Length: 568 bp (1029 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247024 [] (trimmed) GGACGAGCTGGGTTTTCTTGTTTGGGATCCTCGCAAGAATCCAAAAGACCGAACCCATCATATGCCAATTATTACTCCTGCTTACCCTTGCATGA
ACTCTAGCTACAATGTTTCCCCAAGTACTCTTCGAGTAATGATGGACCAATTTCAGTTTGGTAACAAGATTTGTGAGGAGATAGAGTTGAATAAA
GCACAGTGGGGCGCGCTTTTTAAGCATTATCTTTTCTTTGAGGTCTACAAAAACTATCTACAGGTTGACATTGTAGCAGCAGATAATGATGATTT
GCTAGCTTGGAAAGGCTGGGTGGAATCCCGGCTTAGGCAACTGACACTAAAGATAGAGCGGGACACGAACGGGATGTTGCAGTGCCATCCGTATC
CTAATGAATTTGTAGACTTATCTAAGCCATGTCCGCATTGTGCTTTTTTTACGGGCTTGCAGAGGAAACAGGGTGTCAAAGTGCAAGAAGGGCAA
CAATTTGATATTCGTGGCACAGTCGATGAGTTTAAGCAAGATGTAAGCATGTACGCTTACTGGAGACCAGGCATGGATATCTATGTATCTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247024] SGN-U601919 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60439 [Download][View] Facility Assigned ID: TMGGF84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5