Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E247762

Search information 
Request: 247762Match: SGN-E247762
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27233Clone name: cLEF-42-P11
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176678 is on microarray TOM1: SGN-S1-1-5.2.9.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247762Length: 473 bp (1005 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E247762 [] (trimmed) GAACAAATACATAAACCCAAAGGTGAATGGGATCTATAGTTCGAAGGAGTCATTGTATCTATATCTCTGCTATTCTTTTCCATCACACGTTAATA
ATTTTCAATTTAATTACTAACAAAGAGTGACGACGGTGGCCAAAATGAACTTTGGAAAATCTCTGTTAGTTCCTAGTGCCCAAGAGCTTGCCAAA
CAGCATCTAACCAATATTCCCGCCACGTATGTCCGCCCAGAAGAAGAATCTCCCGTCATCTATGCCAGAGCATCCGTCCCAGTTATCGATCTCTA
CAAGTTGATTTCCATGGATTCTGAGCTGCAAAAGCTTCACTCGGCTTGCCAACAATGGGGTTTCCTCCAGGTTATAAACCATGGAGTGACATCTT
CGTTGTTGGAGGATTTCAAGAGAGAGGTTATTGATTTGTTCAAACTTCCAATGGAAGAAAAGAAGAAACTATGGCAACAGGAAGACAGCTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247762] SGN-U604569 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60806 [Download][View] Facility Assigned ID: TMGGK90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0181 Quality Trim Threshold: 14.5