EST details — SGN-E250130

Search information 
Request: 250130Match: SGN-E250130
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C39486Clone name: cLEG-4-F16
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E250130Length: 273 bp (1089 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E250130 [] (trimmed) AGACTGGATTCATCCTTCACATCTTCCGTTAAAGTATGCTGGATACTCGTCATGCTTCCGGAAGGAATCTGGTTCACATGGCCGCGACACACTTG
GAATTTTTAGAGTCCATCAGTTTGAGAAAGTGGAACAGTTCTGTTTAACCAGTCCAAATGGCAATGACTCCTGGGACATGCATGAGGAGATGATT
AAAAACTCAGAGGAATTCTTTCAGCAGCTAAACATTCCTTACCAAATTGTGGCTATTGTTTCTGGCGCACTGAATGATGCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E250130] SGN-U599485 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64744 [Download][View] Facility Assigned ID: TBFAP32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0109 Quality Trim Threshold: 14.5