Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E250868

Search information 
Request: 250868Match: SGN-E250868
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C31471Clone name: cLEG-13-N13
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188057 [TUS-54-D7] Trace: SGN-T351770 EST: SGN-E550895 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E250868Length: 288 bp (562 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E250868 [] (trimmed) TTGGTGTCAGATTTGCTGAGATCTTGACCAAGATTGACAGACGTTCTGGTAAGGAACTTGAGAAGGAGCCCAAGTTTTTGAAGAATGGTGATGCC
GGTATGGTTAAGATGATTCCCACCAAGCCCATGGTTGTTGAGACCTTTGCTGAGTACCCACCATTGGGACGTTTTGCCGTGAGGGACATGCGTCA
GACTGTTGCTGTTGGAGTTGTCAAGAACGTCGACAAGAAAGACCCTACTGGTGCTAAAGTCACCAAGGCTGCCCAAAAGAAGAAGTGATGTGTTT
TTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E250868] SGN-U578831 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66347 [Download][View] Facility Assigned ID: TBFBY79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0236 Quality Trim Threshold: 14.5