EST details — SGN-E252069

Search information 
Request: 252069Match: SGN-E252069
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C45510Clone name: cLEG-8-B20
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252069Length: 342 bp (1072 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E252069 [] (trimmed) GCATTTTACCACTTATTGACAATCATGATTATGTGCGGGGATGGGGTACTGTTTCATTGGTTACCGAGTGCAACATTGTGTTCGGATCCAACTTG
AAAATAATGGGTCCTGGTGAATTTGCTGGTGCGATTGCAATACCATTGCCAGTTGGATCTGTACTTGTCTTGAATGGAAATGGAGCTGATGTAGC
TAAACACTGTGTGCCAGCTGTGCCTACTAATAGGATTTCAATCACATTTAGAAGAATGGATGAATCTAAAAGGCCAACTGGATATGTTCCCGAGC
ATGATTTACAAGGGTTGCAGCCTTTATCATATGAATCAGACTCGCAAAAGAAATCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252069] SGN-U602678 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T65325 [Download][View] Facility Assigned ID: TBFBF10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0277 Quality Trim Threshold: 14.5