Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E252417

Search information 
Request: 252417Match: SGN-E252417
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C31271Clone name: cLEG-12-N17
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188047 [TUS-54-C21] Trace: SGN-T351751 EST: SGN-E550876 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252417Length: 378 bp (1021 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E252417 [] (trimmed) AACTCATGAATGGCTGATTCTGGAAACAAGGCTAAAGCTAGAGATTGATATGATTAGAGCGGAGAAGGAAGAAATTGAGAAGGAGGCTGATCGGT
TGAAAGCTGAGAAAGCTAAATTTGAGACTGAATGGGAGGTAATCGATGAGAAAAGAGAAGAGTTGCAGAAGGAAGCTGATCGTGTGGCTGAAGAG
AAATTGGCCATTTCTAAGCTTCTTAAGGATAGCCGTGACAGCCTGAAAGCAGAGAAAAATGCAATTCAAGAAGAATATAAGCAAAATCTGGAGTC
ACTTTCTCGTGATCGTGATACCTTCATGTATGAGATTGAGAGTGAACGTGCATAATGGTTTAACAAAATCCAGAAAGAACTCGAAAACTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252417] SGN-U584278 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66227 [Download][View] Facility Assigned ID: TBFBU81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0187 Quality Trim Threshold: 14.5