Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E252682

Search information 
Request: 252682Match: SGN-E252682
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32054Clone name: cLEG-16-M11
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252682Length: 433 bp (963 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E252682 [] (trimmed) TTATGACAAAATGAGTGAATATATTTCTTGTGATTATACTAAAGCCGGTGTTAAAGGACTTGAGGATTCTGGAATTACTAAAGTACCTCAAATAT
TCGTTCTACCGCCAAAAGACAGGGCTAAAAAATGTGAAACACATTTCGTTTTTCCAGAGATAGACCTTCAAGGTATCGATGAAGATCCGATTAAG
CATAAGGAGATAGTGGACAAAGTTCGAGATGCATCAGAGAAATGGGGTTTTTTCCAAGTGGTTAATCAAAAACTGGGCATACTCTGGTTGGACAG
AACGTCGCAAGGAACACGACAGTTCTTTGAGCAAGATAACGAGGTTAACAAACAGTATTACACTCGAGATACTGCGAAAAAAGTGGTTTATACTA
GCAATCTTGATTTGTATAAATCTTCTGTTCCAACTGCAAGTTTGGAGAGACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252682] SGN-U592268 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66838 [Download][View] Facility Assigned ID: TBFCI78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0099 Quality Trim Threshold: 20.5