Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E252877

Search information 
Request: 252877Match: SGN-E252877
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32106Clone name: cLEG-16-P11
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252877Length: 273 bp (1116 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E252877 [] (trimmed) AGCGGTGCTGGCGATTCACACGGCTATCAGTTGGTTGTTTGCTACAAATTGAAATTGGGGAAAGTGGGAGCCGCCGTAGCACTGGACATATCGTG
GTGGTTGCTGGTTGTTGGACTGTAATATACGCCGATGCGGGGGTGCCCAGAACTGGATGTTTTTCTACACAAGCATTTTCGGGACTTTGGGAATT
TTTTCGACTCTCCGCTTCTGCTGGTGTCATGCTTTGCTTGGAGAATTGGTACTATATGGATACCTTGATACTTGATGGCCGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252877] SGN-U570359 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67033 [Download][View] Facility Assigned ID: TBFCK90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0276 Quality Trim Threshold: 14.5