Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E253093

Search information 
Request: 253093Match: SGN-E253093
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C33146Clone name: cLEG-25-J15
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E253093Length: 205 bp (847 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E253093 [] (trimmed) TACTGCCTTTGATTGTTGGAACTCTTTAGCAATTTGTGGCATATGCAGTGATCCCCCTGAAGATGCTGTTGTAACAGTTTGTGGACATGTCTTTT
GCAATCAGTGCATTAGTGAGCATCTAACCGGTGATGACACTCAGTGTCCTGTATCTGCTTGCAAAGTTCAGCTGAGTGGTTCTTCAGTTTTCACT
AAAGCAATGTTAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E253093] SGN-U597601 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T68016 [Download][View] Facility Assigned ID: TBFDU56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0314 Quality Trim Threshold: 14.5