Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E255133

Search information 
Request: 255133Match: SGN-E255133
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34733Clone name: cLEG-31-P24
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188164 [TUS-54-H18] Trace: SGN-T351817 EST: SGN-E550942 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255133Length: 172 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E255133 [] (trimmed) TCATGCATGAGAATTGGAGTAAAAGTTCTCTCTTAGACAAAATGACCGATCTTGCTGCAAGAAGAAAGTTAGATGATTTAACTATTGGTCCTGTC
CTTACGGTTACAACTGAAACAATGCTGGACCATGCGAAGAAATTACTTCAGATACCTGGATCGAGATTGCTCTTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255133] SGN-U571120 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69426 [Download][View] Facility Assigned ID: TBFET96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0250 Quality Trim Threshold: 14.5