EST details — SGN-E255133
Search information |
Request: 255133 | Match: SGN-E255133 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C34733 | Clone name: cLEG-31-P24 |
| ||
Library Name: cLEG | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: breaker fruit
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C188164 [TUS-54-H18] | Trace: SGN-T351817 | EST: SGN-E550942 | Direction: 5' | Facility: Giovanni |
Sequence |
Sequence Id: SGN-E255133 | Length: 172 bp (896 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E255133 [] (trimmed)
TCATGCATGAGAATTGGAGTAAAAGTTCTCTCTTAGACAAAATGACCGATCTTGCTGCAAGAAGAAAGTTAGATGATTTAACTATTGGTCCTGTC
CTTACGGTTACAACTGAAACAATGCTGGACCATGCGAAGAAATTACTTCAGATACCTGGATCGAGATTGCTCTTTGG
CTTACGGTTACAACTGAAACAATGCTGGACCATGCGAAGAAATTACTTCAGATACCTGGATCGAGATTGCTCTTTGG
Unigenes |
Current Unigene builds | |||||
[SGN-E255133] | SGN-U571120 | Tomato 200607 | Build 2 | 32 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T69426 [Download][View] | Facility Assigned ID: TBFET96TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.984 | Expected Error Rate: 0.0250 | Quality Trim Threshold: 14.5 |