Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E258546

Search information 
Request: 258546Match: SGN-E258546
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C38792Clone name: cLEG-47-F13
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188310 [TUS-54-N20] Trace: SGN-T352220 EST: SGN-E551345 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258546Length: 454 bp (879 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E258546 [] (trimmed) GTGGAAACAAGAGAAAGTGACTTTGAGGCTTTTGCCTCTGAGAAGGAGGGCACTTCAAATGACATTGTTGAGAAGGCAATAGAGTTTGATCTCTT
ATCTGGGGTCCTGGATTCAGAGGTGACAGAGCTAAGCGGTTTATTATCTTCTGTTGCAACGGAGATTGACAATGTGCGGAAGGTCATATCTTCAC
GTGGCTATGCGGATGAGGCTTTCATTTTGATAGAAGAGAAGTTATACCACAGTGAGAAATCCCTCCAGCAGTTGCAGGACCACCTATTGGAATTG
AGGGCGCCATGTACCAACTTCCCTGGAATTATGCTCACCTCCCACGGGGACCCAGATTGGCAAGATGGCGAGGCAGCAGACTATTTTAACAGTGA
TGCACTTTTAACTCCCAAGACGAAGATAAAAATGCCGACTGTTGAGCAGCAGAGACACATTCTGCGGATGCTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258546] SGN-U599625 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T73716 [Download][View] Facility Assigned ID: TBFHE31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0201 Quality Trim Threshold: 14.5