EST details — SGN-E258994

Search information 
Request: 258994Match: SGN-E258994
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37363Clone name: cLEG-41-N18
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177400 is on microarray TOM1: SGN-S1-1-3.4.7.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177400 [TUS-26-H6] Trace: SGN-T1448 EST: SGN-E378385 Direction: 5' Facility: Giov. Lab
Clone: SGN-C177400 [TUS-26-H6] Trace: SGN-T182716 EST: SGN-E370102 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258994Length: 326 bp (822 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E258994 [] (trimmed) AATACATAACGATATCAATTATTAATTCATTGCAAGTCAAGAAGGAAAATGGAAATGTTGCTTCTCTTCCTAGTAGCTATACCTATCATTGTAAT
TTTCCTTGTAAAACTTAGATACACACATAACCATCCACCAAGTCCCCCTGGACTTCCACTTCTTGGAAACTTGTATCAACTGAATCAAGAATCCC
CACATAAATACCTATGGGAACTTTCAAAGAAATATGGTCCCTTAATGTTCATGAAGCTTGGCTTTTCCCAACTAGTTGTTATTTCATCTTCAAGA
ATTGCTAAAGAAGTTCTAAAAACTCATGACTTTGCATTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258994] SGN-U582222 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72026 [Download][View] Facility Assigned ID: TBFGH81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5