Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E265030

Search information 
Request: 265030Match: SGN-E265030
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47899Clone name: cLEI-2-K23
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E265030Length: 340 bp (864 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E265030 [] (trimmed) AAGCAAAAGGATTCACTGGGCGAAAAGTCCTTTAAAAACATTTCAGTTCATGAAACATTTTAACATCTTCTGAAGCTGCTCATCCAAGGGAACTG
CCATTGGACTAACTGCCCCACAAAAAACAAGCTACATATTCATACATATGCTTCGGACCCAAAAAACTAACGAGAAAAAGCTTTCTATAAAACAA
AGCCGGGAAAGCAAAAACACCAGGGGTTGTTATGCCCTAAAACTCCATTGGGGGGTGGGTTGTGGCCACAATACTACCATAACCACCATCGAAAA
TTGCTTGGCTAGCAACCCCAATTTCCTGACCCTGGGAAAGCATTAAAGCCTGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E265030] SGN-U594084 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T79644 [Download][View] Facility Assigned ID: TGSAE72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.914 Expected Error Rate: 0.0301 Quality Trim Threshold: 14.5