Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E265867

Search information 
Request: 265867Match: SGN-E265867
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C46124Clone name: cLEI-11-F3
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189054 [TUS-56-M20] Trace: SGN-T338813 EST: SGN-E537938 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189054 [TUS-56-M20] Trace: SGN-T338815 EST: SGN-E537940 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E265867Length: 525 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E265867 [] (trimmed) CAGAGTATGGGGACCATATCCGTCCCAGCAGTATGCAGCTGGTGGTCCTATTGGCAATGCTCCTCCTAGTAGCTATCCCCCACCTGGTACTCCAG
TTCCATGGGGACCACCTGTGCCTCCGCCATATGCCCAGTACCCACCTCCTCCTCCTGTCGCAGGTCAACCCATCCCTCCATATGGAATGCAGTAT
CCTCCTTCAATTCCAGCAGCATCTTCTGGTGCCCCTGCTCAGACTGTTTCTTCTGGTGAAAACCAACAAACTTTCACATCTCCTGGTGAGGCACA
ACAAAGCTATCCTCCTGAAATGCAATCTCAGAATGTGTATGGTAACTCTGTCACAACAATGCCACCTAATGCTCAGCCTGCATATCCAACATCAT
CATACAGCTATCCATCTTATTATGGTGTCGCACCACCACCCCCTCCTCCATTTGCATCCCACTCCAATGGGAACCATTCACAGGGTATGAGTAAT
GTTCCCTGGGCTCCGAATCCACCAACTCATGCACCTCCATCATCAGCGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E265867] SGN-U603221 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82022 [Download][View] Facility Assigned ID: TGSBQ26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5