Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E266333

Search information 
Request: 266333Match: SGN-E266333
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48028Clone name: cLEI-3-C21
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E266333Length: 235 bp (697 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E266333 [] (trimmed) GAGAAAGTAAATTTTAAGAGAGAGAAACAAAAACAAACCGTCCTCATGATGGGCAGCTTCATGTACATTGCCATCCTACTTGCTGCCATAATCTC
AACCGTCCATTCCTGCCCGCCATCAGATCGGGCAGCATTATTATCATTCCGAGCTGCCCTAAATGAATCTCACTTGGGTATTTTCAACTCATGGA
AAGGCAACGACTGTTGCCATGAGTGGTACGGGGTGAGTTGNNATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E266333] SGN-U578838 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80021 [Download][View] Facility Assigned ID: TGSAI23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0347 Quality Trim Threshold: 14.5