EST details — SGN-E267250

Search information 
Request: 267250Match: SGN-E267250
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48492Clone name: cLEI-4-L7
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188840 [TUS-56-D22] Trace: SGN-T338445 EST: SGN-E537570 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188840 [TUS-56-D22] Trace: SGN-T338448 EST: SGN-E537573 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E267250Length: 350 bp (789 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E267250 [] (trimmed) GAAGAGCTAAGGTCTTGTTTGGTGTTATTTTTGATTCTTTGATTTCTAATATCTTTGAGAATGGCCACTTCATCTGATGAAGGACAAGTGATCGG
CTGCCACAAGGTTGACGAGTGGAAGGTGCACCTCCAGAAGGGTGTGGAGACCAAAAAACTGGTGGTGGTGGATTTTACTGCTTCCTGGTGCGGCC
CTTGCCGTTTTATTGCCCCAATTCTTGCTGACATTGCTAATAAGATGCCCCATGTTATGTTCCTCAACGCTGATGTCGATGAACTGAATAAATTT
GCCCATGAATGGATTGTGGATGCAATGCCAACTTTTGTCTTCATTAAAGAGGGTAAAAAAATGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E267250] SGN-U593522 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80397 [Download][View] Facility Assigned ID: TGSAO64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0315 Quality Trim Threshold: 14.5