EST details — SGN-E267266

Search information 
Request: 267266Match: SGN-E267266
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48298Clone name: cLEI-4-B14
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E267266Length: 268 bp (907 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E267266 [] (trimmed) CACTAGATTCACTAGTGATACACTACTCTGGCCATGGCACACGAGTACGAGACCATGATGGTGATGAGATTGATGGGCACGACGAATCACTATGC
CCTGTTGATTTTGAGACAGAAGGGAGGATACTAGATGATGAGATCAATAATACCATTGTCAGGCCCTTACCCCGCGGAGCCACACTTCATGGAAT
AATTGATACATGCTTTAGTGGAACTTTCCTAGATTTGCCCTTTTTGTGCAGAATAAACAGGGCAGGATACTTTATGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E267266] SGN-U567679 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80413 [Download][View] Facility Assigned ID: TGSAP07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0281 Quality Trim Threshold: 20.5