EST details — SGN-E267475

Search information 
Request: 267475Match: SGN-E267475
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C49631Clone name: cLEI-8-P13
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E267475Length: 301 bp (860 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E267475 [] (trimmed) TTTTTTTTGGGTTTTGGACAGCCGTGGGAGTAAGGGCATTTTTGACCTTCCAAACTCCAAAATCATCAACAATTCAATGGCCGTCTCTAGTTACG
CTAGGGCATTTCCGTCATTCGAATGTCGTTCGGAGCCTGATTTCTCCGGCAGCCTTCCACATCCTAAAGCCGGCGTTCGGTTCTCCGGCAAGTAT
AACTCCGGGAGTAACCGATCTCAGGTTTATGGACTGTCTTCTTTGATCTATAGGTTTCCGCCTAATTTCGTGATGCAGCTTAGCATTAAGGCTAT
GAAGAATTGCAACAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E267475] SGN-U590566 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T81347 [Download][View] Facility Assigned ID: TGSBE91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0231 Quality Trim Threshold: 14.5