EST details — SGN-E268062

Search information 
Request: 268062Match: SGN-E268062
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47159Clone name: cLEI-15-D24
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189190 [TUS-57-C12] Trace: SGN-T339033 EST: SGN-E538158 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189190 [TUS-57-C12] Trace: SGN-T348885 EST: SGN-E548010 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268062Length: 275 bp (763 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268062 [] (trimmed) CGGATTTTATGTCACGATGTTAAGGCGGGTGGTGTTATTGGGAAATCAGGGAGTATTATTAAGGCGATTAGGCAGCATACTGGGGCATGGGTGAA
TGTACATGAACTGATTCCAGGAGATGATGAACGTATCATTGAGATTTCGGACACTCGGAGGAGGGATCCTGATGGTAGAATGCCGGCGTTTTCGC
CAGCTCAGGAGGCATTGCTGATGATACATGAGAGGATTTTGGATAGTGATAGTGGTGGAGGAGGGTACAGTGGTGGGATGGATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268062] SGN-U581851 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83009 [Download][View] Facility Assigned ID: TGSCH24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0004 Quality Trim Threshold: 14.5