EST details — SGN-E268096

Search information 
Request: 268096Match: SGN-E268096
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47134Clone name: cLEI-15-C13
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189184 [TUS-57-C6] Trace: SGN-T339025 EST: SGN-E538150 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189184 [TUS-57-C6] Trace: SGN-T339026 EST: SGN-E538151 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268096Length: 449 bp (717 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268096 [] (trimmed) GAAGAAAACCAGCCATTAAACTCTTGGACAGCAGCTGCAAAGAAATTGAGTCATTTATCATTGCACCGAGTCCCGGGCCGGGTAATGTTCGTGCG
GAGTTTCTTGCATATGTCACCGAGTCCCTCACTAGAGGGCCGGGAATGTATATTATATATATGATTGGTGATGAGGATGGTTATGATGATGATGA
TGACGGAGATGATGTGATGACTATTTCACTGAGTCCCTCACTAGAGGGCCGGGTGTAGACGCTCAGTTTGGTGATCCTCCCGCCTAGGATATCTA
CTCTGCTGTTTGGGAGAGCTCCACTGTTCCGGAGCCCAGTCGTTTTGGTACATAACTTCTTATGTAGTCTTTTGCTTGTCTATGGGTATGCGGGG
CCCTGTCCCGTCAAGTTTCACTACTATACTCTTAGAGGTCTGTAGACATCGTGTGGGTAGTATAATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268096] SGN-U581462 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83043 [Download][View] Facility Assigned ID: TGSCE19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0118 Quality Trim Threshold: 14.5