EST details — SGN-E268155
| Search information |
| Request: 268155 | Match: SGN-E268155 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C47308 | Clone name: cLEI-15-M24 |
| ||
| Library Name: cLEI | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: whole seedlings
Development Stage: germinating seed
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C189215 [TUS-57-D13] | Trace: SGN-T339069 | EST: SGN-E538194 | Direction: 3' | Facility: INRA (MWG) |
| Clone: SGN-C189215 [TUS-57-D13] | Trace: SGN-T339071 | EST: SGN-E538196 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E268155 | Length: 204 bp (880 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E268155 [] (trimmed)
TCGACTGAATTTTGGTTTGGCTGCTGAACAAGCAAAATTTGAACGTTATAAAGTCGAGATGGTAATCGCCGGTGATGACTGTGCTTTACCACCTC
CAATAGGCATTGCTGGCCTAAAAGGGTTGGCAAGGACGCTTATCGTTCACAAAGCTGCCGGAGCTGCACCAGCTTGCGGTCTTCCCCTTGCTGAC
GTTGCAGCTGAAGC
CAATAGGCATTGCTGGCCTAAAAGGGTTGGCAAGGACGCTTATCGTTCACAAAGCTGCCGGAGCTGCACCAGCTTGCGGTCTTCCCCTTGCTGAC
GTTGCAGCTGAAGC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E268155] | SGN-U579643 | Tomato 200607 | Build 2 | 34 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T83102 [Download][View] | Facility Assigned ID: TGSCF84TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.969 | Expected Error Rate: 0.0345 | Quality Trim Threshold: 14.5 |
Working
