Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E269191

Search information 
Request: 269191Match: SGN-E269191
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47506Clone name: cLEI-16-H19
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177677 is on microarray TOM1: SGN-S1-1-6.3.6.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177677 [TUS-27-C19] Trace: SGN-T182847 EST: SGN-E371339 Direction: 3' Facility: INRA
Clone: SGN-C177677 [TUS-27-C19] Trace: SGN-T182848 EST: SGN-E371340 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E269191Length: 316 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E269191 [] (trimmed) CTAAAATCTACGGGAACATGATGCACACGCCAGAAAGACTGTATGTTGTTCTAGATGGACACAAAAGATCAGTTTATGCTGAACAGCGGTCTACA
AGTCATGCTCACCTTTTATTATTTGTCTGAATGGATCAAACTGGATGTATATGGAATGTGTGGAACCAAAATCACAATAAAGCACGTGTACTTAA
TGGTCACAAAGCGGATGGCAAAGATGTGAAGTGGCCTGCATATGGTCTATTTGGGCTCTATTATGGATATGACTGTACATAAAGGATGATTGATG
ATGCAAAAGGAGCTGCAACCTAAATGTTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E269191] SGN-U596778 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83415 [Download][View] Facility Assigned ID: TGSCK46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0292 Quality Trim Threshold: 14.5