EST details — SGN-E269862

Search information 
Request: 269862Match: SGN-E269862
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61338Clone name: cLEM-17-F9
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189355 [TUS-57-J9] Trace: SGN-T339278 EST: SGN-E538403 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189355 [TUS-57-J9] Trace: SGN-T339281 EST: SGN-E538406 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E269862Length: 192 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E269862 [] (trimmed) GCCAGACTTTAAGGATGACCCATATCTATATGTTTTTCCAAAATTGATATATGTTGGAGTGGAGCTGTGGCTAGTGATTTCTGGAACTTTGTTTG
ACAATGTTGTGATATGCGATGATCCAGAGTTTGCCAAGTCAATTGCTGAGGAAACATGGGGAAAGCTGAAAGATGCTGATAAGGCTGCTTTTGAG
GA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E269862] SGN-U578018 Tomato 200607 Build 2 149 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T86004 [Download][View] Facility Assigned ID: TGFCO29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0286 Quality Trim Threshold: 14.5