EST details — SGN-E270285

Search information 
Request: 270285Match: SGN-E270285
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62194Clone name: cLEM-1-M18
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189284 [TUS-57-G10] Trace: SGN-T339174 EST: SGN-E538299 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189284 [TUS-57-G10] Trace: SGN-T339175 EST: SGN-E538300 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270285Length: 368 bp (705 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270285 [] (trimmed) TTTCATAACCAGACAAGCATAGTCATGTGCTCATTCTTGCCATTCTTCACTTCATTTAATCGAACGAAAGGTGGGCTGATAGAATTAAACCATGG
AAGGCCTCAGCCACTTCAGTATGTAGTCAATGCTGCCTTCCTGGCTACCTTGTATAGTGACTACCTTGCAGCAGCCGACACCCCTGGATGGTATT
GTGGACCTAATTTCTACTCCACCGATGTCCTACGTGAATTTGCACAGACTCAGATTGACTATATCCTTGGCAAGAACCCCAGGAAAATGAGTTAT
GTTGTTGGCTTTGGCAATCACTATCCAAAACGTGTCCACCATCGAGGTGCATCAGTTCCTAAAAACAAGGTCAAGTATAATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270285] SGN-U571690 Tomato 200607 Build 2 82 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83658 [Download][View] Facility Assigned ID: TGFAB81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.997 Expected Error Rate: 0.0187 Quality Trim Threshold: 14.5