EST details — SGN-E270437

Search information 
Request: 270437Match: SGN-E270437
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62150Clone name: cLEM-1-K10
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177777 is on microarray TOM1: SGN-S1-1-2.3.6.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177777 [TUS-27-G23] Trace: SGN-T182869 EST: SGN-E371361 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270437Length: 388 bp (699 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E270437 [] (trimmed) CTTGAGACCTCACAAGAGATAAAGATAAGCAGGCCAAATACCCTTTGTTTTGATTCTGTACCGCTTTGGGGGCTCATCACAATACAAGGAAAGAG
GCCGGAGATGGAAGATACTGCTATAGCTTTACCAAAGTTTCTGAAAATCCCTTCCCATATTTTGACTGATGCGCCAGTTTCTCATGCCCTGAGTC
AAACACTTACAGCCCATTTATATGGGGTTTATGATGGACATGGAGGCTCTCAGGTAGCTAATTATTGTCATGAGCGTCTCCATATGGTTTTAGCA
CAGGAGATAGATATCATGAAAGAGGATCCACATAATGGAAGTGTTAACTGGAAGGAGCAATGGTCAAAGGCTTTCTTGAATTGTTTCTGTAGAGT
CGATGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270437] SGN-U569923 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83810 [Download][View] Facility Assigned ID: TGFAB65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0172 Quality Trim Threshold: 14.5