EST details — SGN-E270519

Search information 
Request: 270519Match: SGN-E270519
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67653Clone name: cLEN-1-I3
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270519Length: 325 bp (811 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E270519 [] (trimmed) CAAAAAAACATAGCGAAATTATGTTTATTTCATGAATACAATTTAATAATATCCTTTCAATATTAAGAATTAATTTATCCCATTTTTTTTTCTAG
GACATATTCTTGTACACCAGGAATATGAATCTTTTCAATATAATATCTCCAATTAATTTTTGTCACATAAATTTCAAAGCTTCCTTTTTTTTCTT
CAGGACATATCTCCCATTAACTTTCTTATGGTGCCATTGGCAAACCAGCCTTTGTAGAACACGTTGGGTTCATAAAGGTTGGTGAAATTCTTCAA
ATATTCAACTTTCTTTTTAATTAAACGTATTTGAGTCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270519] SGN-U599762 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87824 [Download][View] Facility Assigned ID: TRRAA50TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.895 Expected Error Rate: 0.0323 Quality Trim Threshold: 14.5