EST details — SGN-E272149
| Search information |
| Request: 272149 | Match: SGN-E272149 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C68324 | Clone name: cLEN-4-E23 |
| ||
| Library Name: cLEN | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: red ripe to over-ripe
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C189502 [TUS-57-P12] | Trace: SGN-T339500 | EST: SGN-E538625 | Direction: 3' | Facility: INRA (MWG) |
| Clone: SGN-C189502 [TUS-57-P12] | Trace: SGN-T339502 | EST: SGN-E538627 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E272149 | Length: 173 bp (971 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E272149 [] (trimmed)
ACTAATTTTGCCACCGTGAGATTAAGGATCATTTTTGAAAATGGTATTACGGTTGTGAGCAATCAGGTACAACATTCAATTGTTGACATGCGTGC
TCAACACAAAATGGCTGAGCTTTGTCAGCTTACAGGAGTCGAACTTATTACGTCTGTCTCTCTCTTATAACGATACAT
TCAACACAAAATGGCTGAGCTTTGTCAGCTTACAGGAGTCGAACTTATTACGTCTGTCTCTCTCTTATAACGATACAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E272149] | SGN-U594950 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T88166 [Download][View] | Facility Assigned ID: TRRAM36TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.957 | Expected Error Rate: 0.0319 | Quality Trim Threshold: 14.5 |
Working
