EST details — SGN-E272402

Search information 
Request: 272402Match: SGN-E272402
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61812Clone name: cLEM-19-I24
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272402Length: 441 bp (800 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E272402 [] (trimmed) GCAATTTTCTCTGATGTTGGTCCTGATACGAGGTGGGTTGGGAACGAGAATGGTGTTGCTGGAAGCACGTGCTGGTCCCTTTTCAATGGCAGCAA
CGTCAAGATTGGTGGTTATAGTGATGCCAGGTAAGTCTTGTTTGATTAGTCTCTTATTCATCGATCTTCTAATTCCTATTTGCTTTCAGTGAAAA
CTTCTTACCATGTCGTTTACTGTTAGATGTGAATGCCATTTTAGCTAGCAATAACACCTTTAGTAAAAATGAAAGGCCCCATATCACTCTTAAAT
TCCATCAATCGATACAAGAAATCTATATGGAATAAGTGCTTTCACATAATGCATAACAATTCAGTGTCTTTCCTACATCATTCAACTCTTAGTTC
TCGGAACACTAAGCTTCCTTTTATCCCTCTATTTTTTCAATGTATTCAACAGATATTCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272402] SGN-U596747 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T86400 [Download][View] Facility Assigned ID: TGFCV60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5