EST details — SGN-E274434

Search information 
Request: 274434Match: SGN-E274434
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67567Clone name: cLEN-19-I5
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189618 [TUS-58-E8] Trace: SGN-T339699 EST: SGN-E538824 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189618 [TUS-58-E8] Trace: SGN-T348995 EST: SGN-E548120 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E274434Length: 374 bp (747 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E274434 [] (trimmed) ATTGTGAAGAAATGGCTCGTACTAAGCAGACAGCTCGTATAATCAACCGGTGGAAAGGCTTCAAGGAAGCAACTTGCTACAAAGGCTGCAAGGAA
GTCAGCCCCTACCACAGGAGGAGTGAAGAAGCCTGATCGCTACCGACCTGGAACTGTTGCTCTCCGTGAAATCCGAAAATATCAAAAGAGCACTG
AGCTTCTCATCCGGAAGATGCGCATTCCAAAGGCTTGTGCGTGAAATTGCTCAGGATTTTAAGACAGATCTGAGGTTTCAAAGTCATGCTGTGCT
TGCACTCCAAGAAGCCGCTGAAGCTGTATTTAGTTGGTCTCTTTGAGGACACCAACTTGTGTGCCATCCATGCTATTAGAGTCACCATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E274434] SGN-U579782 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91370 [Download][View] Facility Assigned ID: TRRCU51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0233 Quality Trim Threshold: 14.5