EST details — SGN-E275501

Search information 
Request: 275501Match: SGN-E275501
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65659Clone name: cLEN-10-O17
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189555 [TUS-58-B17] Trace: SGN-T339591 EST: SGN-E538716 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189555 [TUS-58-B17] Trace: SGN-T339593 EST: SGN-E538718 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275501Length: 339 bp (453 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E275501 [] (trimmed) GAAAGATGTACCAGCTCCTAGGATGCAATTTGATGATAAGAATCGTGTTGAAAAAGCTAAGAAGCGTGCACTAGTTAAAAAGATTGAAGCTAGAA
ATAGAGTAGAATTGTTTCGGCATTTACCGCAGCATGAACAAGGAACTCAGCTACCTGATCTTGAATCGAGGTTTTTCCACCTTGATACCATGCAT
GCTGCAGTATACAAGGTCGGATTGCAGTATTTGGCTGGAGATGTAGTTGGGGCCAATGCTCGCTGTGTTGCAATGCTACAAGCATTTGAACAAGC
CATCAAAGATTACTCTACACCCTCGGGCAAAAAGCTCTAGGTAGAGATTTAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275501] SGN-U596771 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89373 [Download][View] Facility Assigned ID: TRRBK93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0125 Quality Trim Threshold: 14.5