EST details — SGN-E276348

Search information 
Request: 276348Match: SGN-E276348
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67886Clone name: cLEN-21-P12
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C183187 is on microarray TOM1: SGN-S1-1-8.1.3.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183187 [TUS-41-I9] Trace: SGN-T191496 EST: SGN-E390170 Direction: 5' Facility: INRA
Clone: SGN-C183187 [TUS-41-I9] Trace: SGN-T191706 EST: SGN-E390380 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276348Length: 427 bp (929 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E276348 [] (trimmed) GAAAAGGCAAAACATTCACAATGTAATTCAACAATACCCTAAATCTATTTAGGTCCAAACAGAAACAATAAGTTTGAGCTAACTCATGTATTCAT
AAAATTGAATGAACTCATCTCTCTCTTAACAAGCAACAGCAATTCTTCCGGCAACTTGGTCAAGATCCCGCTGACCACTGGATGTGATCCTCCTT
CCGCCCTTAGGCTCAAAGTCAATGATGTTCATGTTCTGCAACTGTTGAAGAATGTGGCGTGCAACTGAACCACTGCTCCCTTTCTTTAACCGTCA
CCAGCTGACAATGACCCAATTTATCCAGTTAAAGCAAGTAGAAGAGGGTGCTGGTAAGGCTCCACCACCTGTGTTAGTCCTCCATGGCCATTACG
GTGGATGTGTTGGAGATCTTCCCAGCTATGATGCTTTCACACTTGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276348] SGN-U570977 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91607 [Download][View] Facility Assigned ID: TRRDF90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0206 Quality Trim Threshold: 14.5