Notice: Load is currently high due to bots. Some functionality has been turned off.

EST details — SGN-E277448

Search information 
Request: 277448Match: SGN-E277448
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73249Clone name: cLER-3-P1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189686 [TUS-58-H4] Trace: SGN-T339816 EST: SGN-E538941 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189686 [TUS-58-H4] Trace: SGN-T339818 EST: SGN-E538943 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277448Length: 263 bp (764 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E277448 [] (trimmed) AGAGTTAGCTGCTTGCATGTGTGGCCACCAATCAACATGAATAAGGACCAGACACTCTCATACCTTCCTGCTTAGGCTGACTAGCAATTGCATAT
TGAAATTGAGTCCCTTTTGAAAAATGGATAGGGTTTCTTGCTTGGAATTTGAGACTGAGCACGGATTTGTCTACCGTGAGAACAACAAGTCACCA
GGATACTATGATGGAAGGTACTGGACCATGTGGAAAATGCCTATGTTTGGGGGCACTGATGCAACCGAAGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277448] SGN-U591303 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92336 [Download][View] Facility Assigned ID: TPRAK85THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0333 Quality Trim Threshold: 12.5