Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E277500

Search information 
Request: 277500Match: SGN-E277500
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73068Clone name: cLER-3-B19
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189665 [TUS-58-G7] Trace: SGN-T339780 EST: SGN-E538905 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189665 [TUS-58-G7] Trace: SGN-T339782 EST: SGN-E538907 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277500Length: 442 bp (764 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E277500 [] (trimmed) CTCCCTCTCCTGCACCCACAACATCAATAACAAAATCTTGAATATCCTCAGACACAGAGGGACAATTCCCTCTTCGAGAACATGTCTTCTGCAGA
ATCGAAAATGGCACTTGCCAAGACCGTCTTATCTACAGTAGGCTCTGTTGCTGCAACAACCATGGTTGTTCGGACCGTTGCAAATGAGTTGCTGC
CGCACGAATTGTATGATTATCTCTTCTTTGGCCTCAAAAACCTCTTCAGCAGGTTCTCAAATCAGCTAACAATGGTAATTGACGAATTTGATGGC
TTGGTCAACAATGAAATCTATGAAGCAGCTGAAATGTACTTGGGTAACAAGTTGTCAACCAACACCAGGCGAGTCAAAATCAGCAAGCCTGAGAA
GGAGAAACGGTTCAGCATAACATTGGAACACGACGAGGAGGTGACAGATGTTTACAGTGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277500] SGN-U568674 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92388 [Download][View] Facility Assigned ID: TPRAK10THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5