Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E278383

Search information 
Request: 278383Match: SGN-E278383
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C56571Clone name: cLEL-2-D2
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C56571 [cLEL-2-D2] Trace: SGN-T21151 EST: SGN-E278530 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278383Length: 360 bp (590 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E278383 [] (trimmed) CATTTGAAAATTGACATTACAAGAGTGGTTAGAGGTTCAAAGGTAATTAGGTACATAACGTTGTAAAACTCGTATTAACAACAGGAATTAAAAGT
TATACAGATAGATTATTCAATTTATAATGTGGTCTGGAACAGTTTTAAGTTAAATTTGAATACATAATAAGAAGCAAGAATAAAGACAGCACTAA
CAAACTGTGCATGAGTTTGGGAGAATTTCAACTCTTAGAATCCAGGAGATCTGGATATTGAAATTGGCTTCTGTGCCTTAAAACTGTCCATCACA
GAATCAAAGTCACTACGAAGGGAGACAANGGGATCTCTGTCGAAATGCAAAAGCAGCAGTAAACTGTTTAATCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278383] SGN-U603827 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21152 [Download][View] Facility Assigned ID: tomato020413.x
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5