| SGN ID: SGN-C56660 | Clone name: cLEL-2-J19 |  | Order Clone |
|
| Library Name: cLEL | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E278510 | Length: 247 bp (644 bp untrimmed) |
| Status: Current Version | Direction: 3' |
>SGN-E278510 [] (trimmed)
GGTGGCTTCACTGACAATATCCCTCGAGTATTTCCCAAAGGCCTTGGAGCCCTTATTTACGAAGGCTCTTGGCCAATTCCTCCTGTTTTTAAATG
GATTCAAGAGGCCGGAAGAATAGAAGATGCTGAGATGATGCGTACTTTCAATATGGGAGTCGGTATGGTCCTTGTAGTAAGTCCAGAAGCAGCTG
ATGGGATACTTATGGAAGTACAGAAGACAAGCATTGCATACCGGATTGGTGAGGTTG
[BLAST] [AA Translate]
| SGN-ID: SGN-T21112 [Download][View] |
Facility Assigned ID: tomato020358.t3
|
| Submitter: Koni |
Sequencing Facility: Novartis |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.989 |
Expected Error Rate: 0.0092 |
Quality Trim Threshold: 14.5 |