EST details — SGN-E278516

Search information 
Request: 278516Match: SGN-E278516
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C56726Clone name: cLEL-2-P11
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
See unigene SGN-U579745 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278516Length: 224 bp (591 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E278516 [] (trimmed) TGTGTTGGATGGTAGCCTCCACTTTAGTGCCTCAGCCCGCTTGAGTACTGTTAGCACCAACAGAATTGCCTTGTCTAGACCAGGACTCACTGTCA
GAGCCCAACAGGGGTCTGTTGACATCGAAACTAGCCGTAGAGCCATGATTGGTCTTGTTGCTGCTGGCCTAGCTGGTTCCGTTGCTAAAGCAGCT
TTTGCTGAAGCCAGGTCAATTAAGGTTGGACCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278516] SGN-U579745 Tomato 200607 Build 2 181 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21128 [Download][View] Facility Assigned ID: tomato020390.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0222 Quality Trim Threshold: 14.5