EST details — SGN-E278564

Search information 
Request: 278564Match: SGN-E278564
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C56684Clone name: cLEL-2-L4
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C56684 [cLEL-2-L4] Trace: SGN-T21221 EST: SGN-E278418 Direction: 5' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278564Length: 310 bp (1151 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E278564 [] (trimmed) CCCACATGAGCCTTCTCTATACTTGGATGATTTTGTTCGTCTAAAGGCTGGAATGCAGAATGTTATACAGCCCGGGTTACTAAAAGAAGGCTTCT
GTGCAGTCCAGGATGAAAGTGCCGGATTAGTAGTCTCTATTGTTGATCCACAGCCTGGTGAGAACATAATTGATTGTTGTGCTGCTCCAGGAGGG
AAAACCTTGTTCATGGCATCCCGTTTGAATGGCCAAGGTAAATTATTAGCTGTTGACATAAATGAAGGTCGATTGCGGATACTCAGAGAGACAGC
CAAGCTGCACCAAGTTATTGATGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278564] SGN-U597828 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21220 [Download][View] Facility Assigned ID: tomato020462.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0139 Quality Trim Threshold: 14.5