Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E279187

Search information 
Request: 279187Match: SGN-E279187
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59069Clone name: cLEL-4-J10
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59069 [cLEL-4-J10] Trace: SGN-T16288 EST: SGN-E229382 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279187Length: 361 bp (604 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E279187 [] (trimmed) GGCGTATCCGGAGCGATTCTATGCATCGGGATGTAATGCTGGGTTCGATGGATCTTCCGACTCCTCTACAAAAGGTGTCAGCTCCAAATTCTCAA
ACGACGCTGCTCTTCTACTATATGCCCTCTATCAGCAGGCAACTGTCGGACCTTGTAAGATTCCTAAGCCTAGAAGTTGGAGTCCAGTAGAACAA
AGTAAATGGACAAGCTGGAATGGGCTTGGAAACATGGTTTCCACAGAGGCAATGCGTCTTTTTGTGAAAATATTGGAGGAGGAAGATCCAGGATG
GTATTCGAGGGCTTCAAACTTTGTTTCAGAGCCTGCAGTACAAGGTGAAAAGACTAATGAGACCGATACAGAGCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279187] SGN-U574437 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21761 [Download][View] Facility Assigned ID: tomato040453.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0242 Quality Trim Threshold: 14.5