Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E279223

Search information 
Request: 279223Match: SGN-E279223
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C58997Clone name: cLEL-4-G1
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C58997 [cLEL-4-G1] Trace: SGN-T16499 EST: SGN-E229593 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279223Length: 483 bp (978 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E279223 [] (trimmed) GATAACTTCACTTCGTTTCATTTCTATGCTTTTCCTTTGTGCATTCACTCCCATTCTTGGATGCGGCTATTGTGGTAAACCTTCTCACAAGCCCA
AAAAGCCCAAAGTTCCCACTCCCATTGTCAAACCCCCTGTCGATTTGCCCCCTATCGGAATTCCACCGGTCACAGTTCCACCAATTGTAAAACCT
CCAGTTGATTTGCCACCTATTGGAATTCCACCAGTCACAGTTCCACCAGTAATTAAACCATCACCTAAAGGGAAAAAACCTTGTCCACCAACAAC
AAAGGCAACATGCCCAATTGACACATTGAAACTTGGGGCTTGTGTGGATCTTTTAGGTGGGCTTGTTCATATTGGCCTTGGTGATCCAGCTGTTA
ATGAATGTTGTCCAATACTTAGTGGGCTTGATGAACTTGAAGCTGCTGCTTGCCTTTGCACAACACTTAAAGTCAAATTACTTAACCTCAAAATC
TATGTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279223] SGN-U592496 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21489 [Download][View] Facility Assigned ID: tomato040137.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5