EST details — SGN-E280839

Search information 
Request: 280839Match: SGN-E280839
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59801Clone name: cLEL-6-H22
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
See unigene SGN-U577253 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C59801 [cLEL-6-H22] Trace: SGN-T17505 EST: SGN-E234727 Direction: 3' Facility: Cereon
Clone: SGN-C59801 [cLEL-6-H22] Trace: SGN-T17793 EST: SGN-E235015 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280839Length: 251 bp (1219 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E280839 [] (trimmed) CCTTAAGGCTGGTGCTTCACTCCGTTCCAGAGTTAGCACCGGTGCATCCGCTAAGGTGGCAGCTGCCCCAGTTGCCAGATTGACTGTGAAGGCGT
CTTTGAAAGATGTCGGTGCTGTGGTTGCTGCCACCGCTGTTAGCGCGATGCTTGCTAGCAATGCCATGGCACTTGAAGTGTTGCTTGGTGGTGAT
GATGGGAGTCTAGCTTTTATTCCTGGGAACTTCAGCGTTAGTGCTGGTGAGAAAATTACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280839] SGN-U577253 Tomato 200607 Build 2 198 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22286 [Download][View] Facility Assigned ID: tomato060447.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0202 Quality Trim Threshold: 14.5